| Primary Identifier | MGI:6885821 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Ikzf3 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using an sgRNA (targeting GCAGTTTAATATGACGGAGG in exon 4) and an ssODN template (CCTTGTGATCAGCGATCTCCTTTTTCCTCCTTTCTGAAGGCGAACGCCCGTTCCAGTGTAATCAGTGCGGGGCATCTTTTACTCAGAAACGTAATCTCCTCCGTCATATTAAACTGCACACGGGGGAAAAACCTTTTAAGTGTCACCTCTGCAACTACGCATGCCAAAGGAGAGATGCGCTCACGGGACACCTTAGGACA) with CRISPR/Cas9 technology, a G>C mutation was engineered in glycine codon 158, changing it to arginine (p.G158R), to mimic a mutation (p.G159R) found in human patients with adaptive immunity defects (B cell developmental deficiencies and T cell abnormalities). |
