| Primary Identifier | MGI:7413900 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Hemk1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGTGCAGTATGGAACAGCA and GCTCCTGAGGAGCCTCTACA, which resulted in a 2406 bp deletion beginning at Chromosome 9 position 107,329,232 bp and ending after 107,331,637 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001245382, ENSMUSE00001204769, ENSMUSE00001246968, ENSMUSE00001258814 (exons 5-8) and 2047 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 139 and early truncation 10 amino acids later. |
