|  Help  |  About  |  Contact Us

Allele : Rr347<em1Prdns> regulatory region 347; endonuclease-mediated mutation 1, Clare Pridans

Primary Identifier  MGI:7431475 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr347
Strain of Origin  (C57BL/6J x CBA)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  The super-enhancer in intron 2 of Csf1r was targeted with sgRNAs (targeting GAGTCCCTCAGTGTGTGAGAAGG and CAATGAGTCTGTACTGGAGCAGG) using CRISPR/Cas9 technology, resulting in a ~418 bp deletion including the enhancer.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Csf1r<deltaFIRE>,
  • Csf1r<deltaFIRE>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

10 Publication categories

Trail: Allele