|  Help  |  About  |  Contact Us

Allele : Glyr1<em1Dsr> glyoxylate reductase 1 homolog (Arabidopsis); endonuclease-mediated mutation 1, Deepak Srivastava

Primary Identifier  MGI:7279292 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Glyr1
Is Recombinase  false Is Wild Type  false
molecularNote  Using an sgRNA (targeting ATGTATTTCAGGTAGAAGTC) and an ssODN template (AGGTGAGCCTGATACTCGGCGGGCAATTTTCATGTAGATCTTTTAAACTTCTAATGAATGGCTTTCCCTTCTCAGATATCCTACAAGGAAACTTTAAACTGGACTTCTACCTGAAATACATTCAGAAGGATCTCCGCCTCGCCATTGCATTGGGTGATGCAGTCAACCACCCCACTCCCATGGCAGCTGCAGCCAATGAG) with CRISPR/Cas9 technology, proline codon 495 (CCT) was changed to leucine (CTG) (p.P495L). This mutation of the highly conserved proline residue in the beta-hydroxyacid dehydrogenase (betaHAD) domain mimics one found in some congenital heart disease (CHD) patients.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Glyr1<P495L>,
  • Glyr1<P495L>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele