| Primary Identifier | MGI:7254859 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Slc26a4 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using an sgRNA (targeting ATTTTTTACGGCAATGTCGA) and an ssODN template with CRISPR/Cas9 technology, cysteine codon 565 (TGT) in exon 15 was changed to tyrosine (TAT) (c.1694G>A, p.C565Y); also, two silent mutations were introduced to create a diagnostic AclI restriction site. This mutation mimics a human mutation associated with sensorineural hearing impairment (SNHI) but doesn't cause deafness in mouse. |
