| Primary Identifier | MGI:6888277 | Allele Type | Endonuclease-mediated |
| Attribute String | Dominant negative, Humanized sequence | Gene | Tmem43 |
| Inheritance Mode | Dominant | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Using gRNAs (targeting TTAGAGCAGCCCACAGCGGTCGG and CCGATTAGAGCAGCCCACAGCGG) and an ssODN template with CRISPR/Cas9 technology, arginine codon 372 (CGA) in exon 12 was changed to a stop codon (TGA)(c.1114C>T, p.R372*). Proline codon 373 (CCG) was also changed to a stop codon (TGA)(c.1117_1119delinsTGA, p.P373*). The arginine residue is highly conserved and part of loop 3 between the 3rd and 4th transmembrane domains TM3 and TM4 and this mutation is associated with auditory neuropathy spectrum disorder (ANSD) in human. |
