|  Help  |  About  |  Contact Us

Allele : Tmem43<em1Cby> transmembrane protein 43; endonuclease-mediated mutation 1, Byung Yoon Choi

Primary Identifier  MGI:6888277 Allele Type  Endonuclease-mediated
Attribute String  Dominant negative, Humanized sequence Gene  Tmem43
Inheritance Mode  Dominant Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  Using gRNAs (targeting TTAGAGCAGCCCACAGCGGTCGG and CCGATTAGAGCAGCCCACAGCGG) and an ssODN template with CRISPR/Cas9 technology, arginine codon 372 (CGA) in exon 12 was changed to a stop codon (TGA)(c.1114C>T, p.R372*). Proline codon 373 (CCG) was also changed to a stop codon (TGA)(c.1117_1119delinsTGA, p.P373*). The arginine residue is highly conserved and part of loop 3 between the 3rd and 4th transmembrane domains TM3 and TM4 and this mutation is associated with auditory neuropathy spectrum disorder (ANSD) in human.
  • mutations:
  • Single point mutation
  • synonyms:
  • Tmem43<KI>,
  • Tmem43<tm1Cby>,
  • Tmem43-p.(Arg372Ter),
  • Tmem43<tm1Cby>,
  • Tmem43-p.(Arg372Ter),
  • Tmem43<KI>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele