| Primary Identifier | MGI:7413928 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Shkbp1 |
| Inheritance Mode | Not Specified | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAGAATTCCCATCCCCCCA and GATTTGGGTGTAAAAATCTA, which resulted in a 3202 bp deletion beginning at Chromosome 7 position 27,351,614 bp and ending after 27,354,815 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254966, ENSMUSE00001289332, ENSMUSE00001286326, ENSMUSE00001209769, and ENSMUSE00001275973 (exons 5-9) and 2618 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 48 amino acids later. |
