| Primary Identifier | MGI:7280909 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp691 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CACCTGAATGAACATCCACA and AACTGTGTATACCGTCCCCC, which resulted in a 1801 bp deletion beginning at Chromosome 4 position 119,169,330 bp and ending after 119,171,130 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000669588 (exon 2) and 271 bp of flanking intronic sequence including the splice acceptor, the ATG start site and 3â UTR, and is predicted to result in a null allele. |
