| Primary Identifier | MGI:7711747 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Del(2Rr366694-Rr513)1Ndav |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The two adjacent Pax1 enhancers Xe1 and PEC7 were targeted using sgRNAs (equivalent to GAACTTAAGTGGTGGAGTCGAGG and TGATACTGTCCATAAACCTCAGG) with CRISPR/Cas9 technology, resulting in ~9 kb deletions. Three strains were produced with the following deletions: GRCm39:chr2:147401674-147410709 (45-A), 147401674-147410713 (57-B), 147401678-147410715 (57-C). |
