|  Help  |  About  |  Contact Us

Allele : Gt(ROSA)26Sor<em1(CAG-Cd55*)Hgr> gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Peter Heeger
Primary Identifier  MGI:7277810 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready, Inserted expressed sequence Gene  Gt(ROSA)26Sor
Strain of Origin  (DBA/2 x C57BL/6)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  Plasmids encoding gRNAs (AGCACTAGACGTTGAGGTCA and GGCAGGCTTAAAGGCTAACC) are designed to insert a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), followed by a floxed STOP cassette, and the DAF-TM sequence into the endogenous Gt(ROSA)26Sor locus. Specifically, the DAF-TM uses the Cd55 sequence containing the complement regulatory domain, in addition, the signal sequence for glycophosphatidylinositol-(GPI)-anchor addition is replaced with the nonsignaling transmembrane helix domain of human tissue factor.
  • mutations:
  • Insertion
  • synonyms:
  • DAF-TM,
  • DAF-TM
Paste the following link
Quick Links:
SummaryGenomePhenotypeOther
 
Quick Links:
SummaryGenomePhenotypeOther
 
Lists
This Allele isn't in any lists. Upload a list.

1 Feature

Trail: Allele

Genome

1 Expresses

Trail: Allele

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele




MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Copyright © 2017 by The Jackson Laboratory. All Rights Reserved

© 2002 - 2017 Department of Genetics, University of Cambridge, Downing Street,
Cambridge CB2 3EH, United Kingdom