| Primary Identifier | MGI:7258416 | Allele Type | Endonuclease-mediated |
| Gene | Casp8 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using an sgRNA (targeting AAAGGAACAGACTGTGATAA) and an ssODN template with CRISPR/Cas9 technology, threonine codon 265 (ACA) was changed to alanine (GCC) (p.T265A). This is a phosphoblocking mutation that prevents the residue from being phosphorylated in the encoded peptide. |