|  Help  |  About  |  Contact Us

Allele : Casp8<em4Jhan> caspase 8; endonuclease-mediated mutation 4, Jiahuai Han

Primary Identifier  MGI:7258417 Allele Type  Endonuclease-mediated
Gene  Casp8 Is Recombinase  false
Is Wild Type  false
molecularNote  Using sgRNAs (targeting GTGTCGTCTATGGAACGGAT and GCCCATTAGAAGGTGCTTTA) and an ssODN template with CRISPR/Cas9 technology, cysteine codon 362 (TGC) was changed to serine (TCC) (p.C362S). This mutation allows the residue to be phosphorylated in the encoded peptide.
  • mutations:
  • Single point mutation
  • synonyms:
  • Casp8<C362S>,
  • Casp8<C362S>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele