| Primary Identifier | MGI:7284811 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Pak1 |
| Strain of Origin | FVB/N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using an sgRNA (targeting ACATGAGGCTGGGATGAGCGTGG) and an ssODN template (CTTGGCACATGAGGCTGGGATGAGCATGGTTTCAGTGATTGTTCTTGGTT) with CRISPR technology, 3' UTR mutation c.*6C>T (minor allele of SNP rs31627325) was introduced to make the 3' UTR in this FVB/N strain similar to that in the MSM/Ms (Mishima Mus musculus molossinus) strain. The mutation affects the use of the proximal polyadenylation signal and reduces susceptibility to developing skin papillomas. |
