|  Help  |  About  |  Contact Us

Allele : Rr364670<em1Dahe> regulatory region 364670; endonuclease-mediated mutation 1, Daniel Herranz

Primary Identifier  MGI:7287725 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr364670
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Using sgRNAs (targeting GCCGTTCTTCCTAATGTGCA and GGAAGTGTCAACATCACCAG) with CRISPR/Cas9 technology, a genomic region (chr19:33198265-33202359 GRCm39) containing the Pten enhancer, located in intron 4 of Rnls, was deleted.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • PE<->,
  • PE<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories