| Primary Identifier | MGI:7378571 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rnf222 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGACATCCCAGCAGTGCTC and ATAACAGATGAATTGTAGAA, which resulted in a 3534 bp deletion beginning at Chromosome 11 position 68,892,320 bp and ending after 68,895,853 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000466988 (exon 3) and 339 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. |
