| Primary Identifier | MGI:7330328 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fam204a |
| Inheritance Mode | Not Specified | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTACTATTCAGCAGTGTTGT and ATATGTCTGCCAATGACCTA, which resulted in a 1214 bp deletion beginning at Chromosome 19 position 60,220,288 bp and ending after 60,221,501 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001073564, ENSMUSE00000459773,and ENSMUSE00000511602 (exons 2, 3 and 4) and 844 bp of intronic sequence including the splice acceptor, start site and donor and is predicted to result in a null allele. |
