| Primary Identifier | MGI:7330354 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Igfbp6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTACTGGTAGAAGTGGACCT and GGCAGTCTACTGTATTCCAA, which resulted in a 1866 bp deletion beginning at Chromosome 15 position 102,147,772 bp and ending after 102,149,637 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000285923, ENSMUSE00000133145, and ENSMUSE00000444314 (exons 2-4) and 1277 bp of flanking intronic sequence including the splice acceptor, donor as well as 3âUTR is predicted to cause a change of amino acid sequence after residue 112 and early truncation 16 amino acids later. |
