|  Help  |  About  |  Contact Us

Allele : Ctu1<em1(IMPC)J> cytosolic thiouridylase subunit 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7311988 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ctu1
Inheritance Mode  Not Specified Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, GGAGATGGCGTCCTACTGAG and GCAGTCACCCTATTATAGAT, which resulted in a 3606 bp deletion beginning at Chromosome 7 position 43,674,889 bp and ending after 43,678,494 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000279483, ENSMUSE00000401936 (exons 2 and 3) and 1191 bp of intronic sequence including the start site, splice acceptors and donors and is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele