| Primary Identifier | MGI:7330360 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Klhdc8b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGGTGGACTTGAGACCCC and GTAACTTGATCAATTTAGAG, which resulted in a 4121 bp deletion beginning at Chromosome 9 position 108,447,537 bp and ending after 108,451,657 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000221526, ENSMUSE00000221528, ENSMUSE00000243289, ENSMUSE00000221530 and ENSMUSE00000221531 (exons 2-6) and 2120 bp of flanking and intronic sequence including the start site, splice acceptors, donors as well as 3â UTR and is predicted to result in a null allele. There is a 4 bp insertion ACCT at the deletion site. |
