| Primary Identifier | MGI:7330389 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr249 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The intronic Gata2 enhancer was targeted with an sgRNA (targeting TCTCCTGCCGGAGTTTCCTATCCGG) using CRISPR/Cas9 technology, resulting in a 28 bp deletion (CCTGCCGGAGTTTCCTATCCGGACATCT) that deletes the critical C from the CATCTG E-box sequence. |
