| Primary Identifier | MGI:7316637 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Fxn |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 genome editing using guide RNAs [AGACCCCAAACAAGCAAATC; ACAGCCAGATTTGCTTGTTT; and CAGCCAGATTTGCTTGTTTG] selected to target exon 4. Donor DNAs were created encoding an I151F point mutation (ATC to TTC) and a T146T silent mutation (ACC to ACT), which was introduced to destroy the PAM recognition site. Fxn transcript Fxn-201 is used as reference for the exon numbering and the guide/donor sequences. The I151F point mutation corresponds to the human I154F mutation associated with Friedreich's Ataxia. |
