|  Help  |  About  |  Contact Us

Allele : Fam163b<em1(IMPC)J> family with sequence similarity 163, member B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7327066 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Fam163b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTGCCTGAAGGTGCCCAG and TCTCTACAAGACCATCAAGA, which resulted in a 3410 bp deletion beginning at Chromosome 2 position 27,110,337 bp and ending after 27,113,746 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000851960 and ENSMUSE00000737448 (exons 2 and 3) and 783 bp of intronic sequence including the splice acceptor start site and splice donor and is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele