| Primary Identifier | MGI:7327066 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fam163b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTGCCTGAAGGTGCCCAG and TCTCTACAAGACCATCAAGA, which resulted in a 3410 bp deletion beginning at Chromosome 2 position 27,110,337 bp and ending after 27,113,746 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000851960 and ENSMUSE00000737448 (exons 2 and 3) and 783 bp of intronic sequence including the splice acceptor start site and splice donor and is predicted to result in a null allele. |
