|  Help  |  About  |  Contact Us

Allele : Rr44608<em2Ddu> regulatory region 44608; endonuclease-mediated mutation 2, Denis Duboule

Primary Identifier  MGI:7327109 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr44608
Strain of Origin  C57BL/6 x CBA Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (targeting ACAGCGCCTCCTCCTGGACA) with CRISPR/Cas9 technology, a 7 bp deletion (GAGGAGG) was created in this Hoxd CTCF binding site region.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Del(CBS1),
  • deltaCB1',
  • Del(CBS1),
  • deltaCB1'
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele