|  Help  |  About  |  Contact Us

Allele : Clu<em1(CLU*)Aduci> clusterin; endonuclease-mediated mutation 1, Frank LaFerla

Primary Identifier  MGI:7327106 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence, Inserted expressed sequence Gene  Clu
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Guide RNAs (GCAGATCCATATCTGGCTGA, TTGCCCCCTTCAGCCAGATA, TGAACTGCCCTCGCTTGTAC and CTTGAGTGCCTGTACAAGCG) are designed to replace part of the gene with an approximately 2kb region of human DNA sequence, including a human SNP rs2279590. To humanize the 3' end of the locus, the human SNP rs2279590 was introduced; the SNP has been associated with increased risk of late-onset Alzheimer's disease (LOAD). Specifically, DNA sequence from nucleotide position 27,596,915 to 27,598,786 (inclusive) on human chromosome 8 (GRCh38) is inserted between nucleotide positions 66,218,203 and 66,220,390 on mouse chromosome 14 (GRCm39), replacing the intervening mouse genomic DNA sequence.
  • mutations:
  • Insertion
  • synonyms:
  • Clu-h2kbKI,
  • Clu-h2kbKI
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

1 Expresses

Trail: Allele

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele