| Primary Identifier | MGI:7328430 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gm14569 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTATCCTGATCCCTTCTCAA and GCGAGGGATTAAGAATTGAA, which resulted in a 232 bp deletion beginning at Chromosome X position 36,479,785 bp and ending after 36,480,016 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001253026 (exon 3) and 105 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 49 amino acids later. |
