| Primary Identifier | MGI:7329961 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Syngr2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGTAGGACATATTTCCCAG and CTAGGGGTGGAGATACACTT, which resulted in a 4837 bp deletion beginning at Chromosome 11 position 117,809,495 bp and ending after 117,814,331 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001246954, ENSMUSE00000151668, ENSMUSE00001250072 and ENSMUSE00000402864 (exons 1-4) and 866 bp of flanking intronic sequence including the start site, splice acceptor and donor as well as 3â UTR and is predicted to result in a null allele. |
