|  Help  |  About  |  Contact Us

Allele : Syngr2<em1(IMPC)J> synaptogyrin 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7329961 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Syngr2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGTAGGACATATTTCCCAG and CTAGGGGTGGAGATACACTT, which resulted in a 4837 bp deletion beginning at Chromosome 11 position 117,809,495 bp and ending after 117,814,331 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001246954, ENSMUSE00000151668, ENSMUSE00001250072 and ENSMUSE00000402864 (exons 1-4) and 866 bp of flanking intronic sequence including the start site, splice acceptor and donor as well as 3’ UTR and is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele