|  Help  |  About  |  Contact Us

Allele : Rr29<em2Axvi> regulatory region 29; endonuclease-mediated mutation 2, Axel Visel

Primary Identifier  MGI:7334950 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region, Null/knockout Gene  Rr29
Strain of Origin  FVB Is Recombinase  false
Is Wild Type  false
molecularNote  Sequence for Shh enhancer ZRS or MFCS1 (mammals-fish conserved sequence 1), located in intron 5 of Lmbr1, was replaced with the same length (1324 bp) orthologous human sequence (chr7:156,790,708-156,792,031 (GRCh38)) using an sgRNA (targeting AGTACCATGCGTGTGTGTGA) and a plasmid DNA template with CRISPR/Cas9 technology.
  • mutations:
  • Intragenic deletion,
  • Insertion
  • synonyms:
  • Shh-hZRS<em2Axvi>,
  • Shh-hZRS<em2Axvi>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele