|  Help  |  About  |  Contact Us

Allele : Ccdc184<em1(IMPC)J> coiled-coil domain containing 184; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7330216 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ccdc184
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGACGCTATTTAAAGCGCTG and ATACCCGGCCCGGCTAACAA, which resulted in a 3243 bp deletion beginning at Chromosome 15 position 98,167,142 bp and ending after 98,170,384 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000409713 (exon 1) and 266 bp of flanking sequence including the splice acceptor and donor and start site as well as 3’UTR and is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele