|  Help  |  About  |  Contact Us

Allele : Rr283<em1Hhoj> regulatory region 283; endonuclease-mediated mutation 1, Hironori Hojo
Primary Identifier  MGI:7345610 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rr283
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 genome editing is used to remove the Sp7 enhancer (chr15:102207224-102208686, mm9) region using single guide RNA target sequences flanking the enhancer (50 sgRNA-1: ggcatctccaccgcttacgctgg; 50 sgRNA-2: ccaccgct tacgctggccacct; 30 sgRNA-1: ccaagaagttagacggggatggg; and 30 sgRNA-2: gggtggtatcccgttatttttgg).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Sp7Enh-Ob,
  • Sp7Enh-Ob
Paste the following link
Quick Links:
SummaryGenomePhenotypeOther
 
Quick Links:
SummaryGenomePhenotypeOther
 
Lists
This Allele isn't in any lists. Upload a list.

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele




MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Copyright © 2017 by The Jackson Laboratory. All Rights Reserved

© 2002 - 2017 Department of Genetics, University of Cambridge, Downing Street,
Cambridge CB2 3EH, United Kingdom