|  Help  |  About  |  Contact Us

Allele : Rr283<em1Hhoj> regulatory region 283; endonuclease-mediated mutation 1, Hironori Hojo

Primary Identifier  MGI:7345610 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rr283
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 genome editing is used to remove the Sp7 enhancer (chr15:102207224-102208686, mm9) region using single guide RNA target sequences flanking the enhancer (50 sgRNA-1: ggcatctccaccgcttacgctgg; 50 sgRNA-2: ccaccgct tacgctggccacct; 30 sgRNA-1: ccaagaagttagacggggatggg; and 30 sgRNA-2: gggtggtatcccgttatttttgg).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Sp7Enh-Ob,
  • Sp7Enh-Ob
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele