| Primary Identifier | MGI:7346397 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr284 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | This Grem1 limb regulatory region, located in Fmn1 intron 13 [in reference to ENSMUST00000081349], was targeted with sgRNAs (targeting CACCGCCTGTGATCCATCGAATGCC and AAACGGCATTCGATGGATCACAGGC) using CRISPR/Cas9 technology, resulting in an 8.3 kb deletion (chr2:113503131-113511422 GRCm39). |
