Primary Identifier | MGI:7338999 | Allele Type | Endonuclease-mediated |
Attribute String | Modified regulatory region | Gene | Rr268 |
Strain of Origin | C57BL/6J | Is Recombinase | false |
Is Wild Type | false |
molecularNote | The GG2-GG1/A2-C1 enhancer element of the Ins2 promoter was targeted with sgRNAs (targeting CTTTCTGCAGACCTAGCACCAGG and AAACTGCAGCTTCAGCCCCTCTGG) using CRISPR/Cas9 technology, resulting in a 3 bp deletion (CCC) in the C1 element. |