| Primary Identifier | MGI:7339015 | Allele Type | Endonuclease-mediated |
| Gene | Ppp1r15a | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | CRISPR/cas9 genome editing uses guide RNAs (AGCGGGTTCATGTCGCCCTC) to create an ATG to ATA mutation, resulting in a methionine to isoleucine change, in the start codon of the third upstream open reading frame (uORF3, analogous to human uORF2). A silent protospacer adjacent motif (PAM) site mutation was introduced to prevent gRNA editing of the donor template. |
