| Primary Identifier | MGI:7339045 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Ryr1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Alanine codon 4330 (GCC) in exon 91 was changed to aspartic acid (GAC) (ENSMUSP00000137123:p.A4330D) using an sgRNA (targeting GAGCAGCGCGGCCACCGCCGTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.A4329D mutation associated with congenital myopathy 1B (multiminicore disease (MmD)). |
