| Primary Identifier | MGI:7378848 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Saysd1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAAGGATAGGAGGAACAGC and AGAGGGACTGCTGTGCTCTC, which resulted in a 317 bp deletion beginning at Chromosome 14 position 20,077,304 bp and ending after 20,077,620 bp (GRCm38/mm10). This mutation deletes 317 bp from ENSMUSE00000413605 (exon 2) and is predicted to cause a change of amino acid sequence after residue 78 and early truncation 48 amino acids later. |
