|  Help  |  About  |  Contact Us

Allele : Adar<em3Qwan> adenosine deaminase, RNA-specific; endonuclease-mediated mutation 3, Qingde Wang

Primary Identifier  MGI:7484703 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Adar
Is Recombinase  false Is Wild Type  false
molecularNote  Lysine codon 948 (AAG) was changed to asparagine (AAT) (c.2844G>T p.K948N) using an sgRNA (targeting GCAAGGCAAGCTTCGCACCA) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.K999N mutation associated with Aicardi-Goutieres syndrome (AGS).
  • mutations:
  • Single point mutation
  • synonyms:
  • ADAR1<K999N>,
  • ADAR1<K999N>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele