| Primary Identifier | MGI:7484703 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Adar |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Lysine codon 948 (AAG) was changed to asparagine (AAT) (c.2844G>T p.K948N) using an sgRNA (targeting GCAAGGCAAGCTTCGCACCA) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.K999N mutation associated with Aicardi-Goutieres syndrome (AGS). |
