| Primary Identifier | MGI:7484391 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Ret |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Methionine codon 919 (ATG) was changed to threonine (ACC) (p.M919T) using an sgRNA (targeting CCGGATTCCCGTCAAGTGGATGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.M918T mutation associated with multiple endocrine neoplasia type 2B (MEN2B). |