| Primary Identifier | MGI:7484389 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Ret |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Asparagine codon 396 (AAC) was changed to lysine (AAG) (p.N396K) using an sgRNA (targeting CCATTTCAACGTGTCTGTACTG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.N394K mutation associated with Hirschsprung disease (HSCR). |
