| Primary Identifier | MGI:7484675 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Clp1 |
| Strain of Origin | (C57BL/6J x SJL/J)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Arginine codon 140 (CGT) in exon 2 was targeted for change to histidine (CAT) (c.419G>A p.R140H) using an sgRNA (targeting AACGCACTGCGTAGTTGAGT) and an ssODN template with CRISPR/Cas9 technology. This allele represents an incompletely repaired sequence with a 4 bp deletion around the intended mutation (c.417_420delGCGT) that introduces a frameshift and a premature stop codon shortly thereafter (p.R140Wfs*10) and is thus a knock-out allele. |
