|  Help  |  About  |  Contact Us

Allele : Gt(ROSA)26Sor<em1(LoxCode)Naik> gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Shalin Naik

Primary Identifier  MGI:7380576 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready, Lineage barcode Gene  Gt(ROSA)26Sor
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Plasmids encoding a guide RNA (CTCCAGTCTTTCTAGAAGAT) are designed to insert the LoxCode cassette into the endogenous Gt(ROSA)26Sor locus. The LoxCode cassette is composed of 14 loxP sites in alternating orientation flanking 13 small (8-14nts) code elements. Upon Cre exposure, random recombination between the loxP sites lead to inversions and excisions, resulting in DNA sequence reshuffling with a theoretical DNA diversity of over 30 billion barcodes.
  • mutations:
  • Insertion
  • synonyms:
  • LoxCode,
  • LoxCode,
  • Gt(ROSA)26Sor<em1Naik>,
  • Gt(ROSA)26Sor<em1Naik>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele