| Primary Identifier | MGI:7367264 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rab3il1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGACATTAACCCCATGTTG and TCATATCCCAGTCCCCCCCA, which resulted in a 2304 bp deletion beginning at Chromosome 19 position 10,028,253 bp and ending after 10,030,556 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000144232, ENSMUSE00000144233, and ENSMUSE00000144237 (exons 5,6, and 7) and 1843 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 147 and early truncation 20 amino acids later. |
