|  Help  |  About  |  Contact Us

Allele : Rr115<em1Bobh> regulatory region 115; endonuclease-mediated mutation 1, Robert E Hill

Primary Identifier  MGI:7367576 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr115
Strain of Origin  (C57BL/6J x CBA)F2 Is Recombinase  false
Is Wild Type  false
molecularNote  Shh brain enhancer 2 (SBE2) was targeted with sgRNAs (targeting AAACACATTAAAGCCCTCCAGCG, CACCGACGCTGGAGGGCTTTAATGT, AAACACGAGCAAGCCAACCGGAGG and CACCGCTCCGGTTGGCTTGCTCGT) using CRISPR/Cas9 technology, resulting in a 1.2 kb deletion.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Shh<deltaSBE2>,
  • Shh<deltaSBE2>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele