| Primary Identifier | MGI:7343914 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ttc39c |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTAGATCATGGCCAAAGGA and GCGTATATATGATTTTTAGA, which resulted in a 510 bp deletion beginning at Chromosome 18 position 12,817,618 bp and ending after 12,818,127 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001244258 (exon 2) and 461 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 2 amino acids later. |
