| Primary Identifier | MGI:7367486 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr304 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A G>A mutation was engineered in the Tenm1 cis-regulatory element (CRE) using an sgRNA (targeting AATATTATTAGCCACACATTTGG) and a ssODN template (TAAGATGGATTCATATTAGGGCTCAAATGCATTGATAGCATTCTACATATTTTTATCCATTTTTATTCCAAGCTACTTTTATCCAAATAGTTATAGACACAAGGTTATTGCAAATTGTATTTGTCTGCTGCCATAGTGCTTTCTATTTTAGAGGAGTAGAAGTAACTATCTCCTTAACAA) with CRISPR/Cas9 technology. The mutation mimics one found in some families with individuals presenting with X-linked intellectual disability (XLID). |
