| Primary Identifier | MGI:7384342 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Kcnma1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/Cas9 endonuclease-mediated genome editing was used with an sgRNA (targeting GGACCGGGATGATGTCAACG) and ssODN template (CTCTGGAGAGTGTCTCTAACTTCCTGAAGGACTTTCTGCACAAGGACCGtGgTGATGTCAACGTtGAGATTGTCTTTCTTCACAAGTAAGAGCCCCCTGCTGCCACCAGACCCTGCCACC) to change aspartic acid codon 434 (GAT) to serine (GGT) (ENSMUSP00000153247:p.D434G). The mutation is associated with paroxysmal dyskinesia in KCNMA1-linked channelopathy patients. The affected aspartic acid residue is located within the alphaA and alphaB of the AC domain, which is within the regulator of conductance of potassium 1 (RCK1) domain. |
