|  Help  |  About  |  Contact Us

Allele : Rr323<em1Juhi> regulatory region 323; endonuclease-mediated mutation 1, Junji Hirota

Primary Identifier  MGI:7384821 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr323
Strain of Origin  (C57BL/6 x C3H)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  The class I olfactory receptor olfactory sensory neuron (OSN) enhancer was targeted with sgRNAs (targeting CACCGTCTCATTGCCACCCGGATGA, AAACTCATCCGGGTGGCAATGAGAC, CACCGCCCCTCCACCGTACTTGCA and AAACTGCAAGTACGGTGGAGGGGC) using CRISPR/Cas9 technology, resulting in a 1982 bp deletion.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • deltaJ,
  • deltaJ
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele