| Primary Identifier | MGI:7385113 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Krtap1-3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATGGGATGAATTCCAACAG and GCCAGGGATTATAAAAAGAC, which resulted in a 1322 bp deletion beginning at Chromosome 11 position 99,590,083 bp and ending after 99,591,404 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000665082 (exon 1) and 443 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. |
