| Primary Identifier | MGI:7386928 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ly6g5b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGACTTCTGGTCCTTCCCT and CTACTGTTCGCTTCCACGTA, which resulted in a 365 bp deletion beginning at Chromosome 17 position 35,114,431 bp and ending after 35,114,795 bp (GRCm38/mm10). This mutation deletes 365 bp from ENSMUSE00000932901 (exon 3) and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 2 amino acids later. |
