|  Help  |  About  |  Contact Us

Allele : Tjap1<em1(IMPC)J> tight junction associated protein 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7386930 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tjap1
Inheritance Mode  Not Specified Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTGTGGCCACAACATAGCG and GGGTTACTAAATAAAGTCAG, which resulted in a 468 bp deletion beginning at Chromosome 17 position 46,260,872 bp and ending after 46,261,339 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000136628 (exon 8) and 401 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 97 and early truncation 17 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele