|  Help  |  About  |  Contact Us

Allele : Dp(11)6Smun duplication, Chr 11, Stefan Mundlos 6

Primary Identifier  MGI:7398597 Allele Type  Endonuclease-mediated
Gene  Dp(11)6Smun Transmission  Germline
Strain of Origin  129P2/OlaHsd Is Recombinase  false
Is Wild Type  false
molecularNote  The duplication (chr11:111782129-112202448 (GRCm39)) allele was created through targeting with sgRNAs (targeting CACCGTGCTGAAGTTGAACGATGCG and CACCGTTAGAAATCCTTGTCCCAAC) using CRISPR/Cas9 technology. It duplicates the central section of the Sox9 topologically associated domain (TAD) but not the gene itself.
  • mutations:
  • Insertion,
  • Duplication
  • synonyms:
  • Dup-S,
  • Dup-S
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele