|  Help  |  About  |  Contact Us

Allele : Ankdd1b<em1(IMPC)J> ankyrin repeat and death domain containing 1B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7388263 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ankdd1b
Inheritance Mode  Not Specified Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTACACTCCTGAGAATGTT and CTTTTGTCATCCAAGTTGGA, which resulted in a 524 bp deletion beginning at Chromosome 13 position 96,420,527 bp and ending after 96,421,050 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001289218 (exon 13) and 322 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 423 and early truncation 21 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele